Skip to main content

Advertisement

Table 1 Primers used in this study

From: Hc-hrg-2, a glutathione transferase gene, regulates heme homeostasis in the blood-feeding parasitic nematode Haemonchus contortus

Primer IDUsed forPrimer sequence (5ʹ–3ʹ)
Hc-hrg-2-FcDNA and genomic DNAATGATTCTCTTGGTTTCTGTTGCTG
Hc-hrg-2-RcDNA and genomic DNAAGCAAACTCTTTTCCAAAAACCGTATCTCG
PE-Hc-hrg-2-FProkaryotic expressionCGGGATCCATGATTCTCTTGGTTTCTGTTGCTG
PE-Hc-hrg-2-RProkaryotic expressionCCCAAGCTTTCATTCTTCAGCAAACTCTTTTCCAAAAA
RA-Hc-hrg-2-R13ʹ RACECCTAAATTACCTGTCCCACTCCC
RA-Hc-hrg-2-R23ʹ RACEGTTAAAACGAGCGTGAGGCCAT
real-Hc-hrg-2-Freal-time PCRACTGCCCATAGTGCTTCCAC
real-Hc-hrg-2-Rreal-time PCRAGTCCTCGACAGGGAACTGA
Real-Hc-actin-1-Freal-time PCRTCAATTGTCGGACGTCCTCG
Real-Hc-actin-1-Rreal-time PCRAGGGGAGCTTCGGTCAAAAG
EE-Hc-hrg-2-FEukaryotic expressionCGGAATTCATGATTCTCTTGGTTTCTGTTGCTG
EE-Hc-hrg-2-REukaryotic expressionCGGGATCCTCATTCTTCAGCAAACTCTTTTCCAAAAA
EE-Hc-hrg-2(ΔTMD)-FEukaryotic expressionCGGAATTCATGATTCTCAAGAAGGACAAGAAAGAGGTT
EE-Hc-hrg-2(ΔTMD)-REukaryotic expressionCGGGATCCTCATTCTTCAGCAAACTCTTTTCCA
EE-Hc-hrg-2(ΔGST-N)-F1Eukaryotic expressionCGGAATTCATGATTCTCTTGGTTTCTGTTGCTG
EE-Hc-hrg-2(ΔGST-N)-R1Eukaryotic expressionCGACGCGAGAGGCTTCACGGTATCGGATTTCCA
EE-Hc-hrg-2(ΔGST-N)-F2Eukaryotic expressionGTGAAGCCTCTCGCGTCGTCTA
EE-Hc-hrg-2(ΔGST-N)-R2Eukaryotic expressionCGGGATCCTCATTCTTCAGCAAACTCTTTTCCA
EE-Hc-hrg-2(ΔGST-C)-F1Eukaryotic expressionCGGAATTCATGATTCTCTTGGTTTCTGTTGCTGTCTGG
EE-Hc-hrg-2(ΔGST-C)-R1Eukaryotic expressionTTTTCCAAAAACCGTATCCTTGAAGTCCTCGAC
EE-Hc-hrg-2(ΔGST-C)-R2Eukaryotic expressionCGGGATCCTCATTCTTCAGCAAACTCTTTTCCAAAAAC
EE-Hc-hrg-2(TMD)-FEukaryotic expressionCGACCGGTCGCCACCATGGTGAGCAAGGG
EE-Hc-hrg-2(TMD)-R1Eukaryotic expressionAACGACAGCCAACCAGACAGCAACAGAAACCAAGAAGCTTGAGCTCGAGATCTT
EE-Hc-hrg-2(TMD)-R2Eukaryotic expressionCGGAATTCCTACAAGAAAACAAAATATGCGACGATACTAACGACAGCCAACCAGACAG
  1. Note: Restriction sites are underlined