Skip to main content

Table 1 Sequences of different primer sets used for qPCR

From: Investigation of three enzymes and their roles in the embryonic development of parthenogenetic Haemaphysalis longicornis

GenePrimer sequence (5ʹ-3ʹ)Amplicon size (bp)
Cathepsin BF: GCGTGGAGCTACTGGGTG133
R: TGCTCTTGTCGCAGGGTC
Cathepsin DF: CGGCGTGAAAGTAGGCGATAA88
R: CGGCCCAGCAATCAAGGAG
Acid phosphataseF: CACGCACAAAGGTAAAAA180
R: CACACTTTCTTGTCCCGT
β-actinF: CGTTCCTGGGTATGGAATCG70
R: TCCACGTCGCACTTCATGAT