Skip to main content

Table 2 Sequences of different primer sets used for RNAi

From: Investigation of three enzymes and their roles in the embryonic development of parthenogenetic Haemaphysalis longicornis

GenePrimer sequence (5ʹ-3ʹ)Amplicon size (bp)
Cathepsin B (T7)F: TAATACGACTCACTATAGGATTGTCCACCTCGCTGCC430
R: TAATACGACTCACTATAGGGGTCCGTGTGCCTCTGGT
Cathepsin D (T7)F: TAATACGACTCACTATAGGTGTTCGACACCGGCTCCT497
R: TAATACGACTCACTATAGGCTGCCAGTAGCCCTTGCG
Acid phosphatase (T7)F: TAATACGACTCACTATAGGGGTCACATCACGCACAAA539
R: TAATACGACTCACTATAGGTGCAGGGTGCTGTTGTAG
GFP (T7)F: TAATACGACTCACTATAGGGACGTAAACGGCCACAAGT583
R: TAATACGACTCACTATAGGGCTTCTCGTTGGGGTCTTT