Skip to main content

Table 3 Characteristics of 16 microsatellites and primer sets

From: Development of genome-wide polymorphic microsatellite markers for Trichinella spiralis

NamePrimer sequence (5′-3′)Repeat motifProduct size (bp)Contig/IDPositionTm (°C)
TsMs01F: GGGCATATATTACGCATACCG
R: ACGACGAAATGATTCTTGCC
(TG)25265–297gi31697283640205–4048158
TsMs02F: GATTGGGCAAAGGATGAATG
R: AAAACGACGGCAAATCAAAC
(TTTG)9157–177gi31697283618217–1837458
TsMs03F: TGTTACTTCATGTGGCAGAGTG
R: GCCAACTGGATTTTAATGACAGA
(TAATT)17221–297gi316972363130723–13100160
TsMs04F: CTAAGGCATCGCTGGTTTTT
R: TGATTGGCTATCAAGCAACG
(ATC)11246–275gi31697309019425–1967558
TsMs05F: CGACAACTTCAACGACGGTA
R: TCGCTTCATCAGAGGGAACT
(GTTT)9260–292gi316969813186555–18680160
TsMs06F: TAATGCTGGTTTGCGCTATG
R: AACTGAGCGGAAATTTTGACA
(TAA)10210–302gi316973625143441–14366860
TsMs07F: GGCCGTTTTGAAATGAAAAAT
R: GCGTTGATTCAGCTAAGCGT
(ATA)9252–276gi316976532119918–12019660
TsMs08F: GGGTGTCGTTGTCATTTGTG
R: GGTGCGTGGAAATTGAAAAT
(TAG)11259–290gi316978307145640–14588358
TsMs09F: CCTGCGGTTATTGTTTGCTT
R: AGCCGGAGAGAATATGGGAT
(GTA)9(GTT)8275–298gi31697815485694–8596158
TsMs10F: ACAGCCCATATTTTTCGACG
R: CCAATTTTAAGCACATTGCG
(TAACA)6212–245gi31697929617474–1775060
TsMs11F: GGATAGCACGTATTGGCGAT
R: TTCAATGCTTTTCGATGCAG
(ACACAT)6167–197gi31697826256111–5638758
TsMs12F: TGGAACAAATGCCATTCAAA
R: CCCTGAGCGCAATGTAAAGT
(AAG)11(ATG)5210–226gi31696923619887–2008858
TsMs13F: GGTAAATGAGGTTCGCGTTC
R: AGGATGTTATTCGCCCAGAA
(ATAA)8213–272gi31696756166833–6700960
TsMs14F: TCCTGACCCAGTCCATTGAT
R: AAATCGATAAGCATTTGGCG
(CTT)8210–226gi316977317111618–11182458
TsMs15F: CCTACGCGATCAAGTGTTCA
R: CTGCGTTTGTCCTCTGTTCA
(TTTG)7213–272gi31697188983295–8350056
TsMs16F: GCCACCAGAGTGGACAAAAT
R: GCGTTGAGTGAAGTGATGGA
(TAT)22215–245gi31697749266935–6719060