Skip to main content

Table 2 Species-specific PCR primers for the identification of Ae. aegypti

From: A potential global surveillance tool for effective, low-cost sampling of invasive Aedes mosquito eggs from tyres using adhesive tape

SpeciesPrimer codeSequence (5ʹ-3ʹ)Reference
Universal forward primerAUFTCAAAATTAAGGGTAGTGGT[52]
Universal reverse primerAURGACTTCAACTGGCTTGAACT[52]