Skip to main content

Advertisement

Table 2 Species-specific PCR primers for the identification of Ae. aegypti

From: A potential global surveillance tool for effective, low-cost sampling of invasive Aedes mosquito eggs from tyres using adhesive tape

SpeciesPrimer codeSequence (5ʹ-3ʹ)Reference
Universal forward primerAUFTCAAAATTAAGGGTAGTGGT[52]
Universal reverse primerAURGACTTCAACTGGCTTGAACT[52]
Ae. aegyptiAEGGACACCGAGGCGCCCATTGC[52]
Universal forward primer18FHINGTAAGCTTCCTTTGTACACACCGCCCG[53]
Universal reverse primerCP16GCGGGTACCATGCTTAAATTTAGGGGGTA[53]
Ae. aegyptiaeg.r1TAACGGACACCGTTCTAGGCCCT[53]