Skip to main content

Table 2 Primer sequences and characteristics of 12 polymorphic microsatellite loci

From: Genetic differentiation and population structure of Anopheles funestus from Uganda and the southern African countries of Malawi, Mozambique, Zambia and Zimbabwe

LocusChromosome armRepeat motifNo. of allelesAllele sizePrimer sequence (5′-3′)Reference
FunL F2L(GT)812181–197HEX-AACAGTGGAAGGCAAATTGCCohuet et al. [22]
FunL RGCACGGTTACCACTGCTCA
AFUB10 F2L(GCT)3+2+4+56195–210PET-TGTCCATGTACAACCGCAACSharakov et al. [23]
AFUB10 RTTCTCCAGCATCATCAGCAC
AFUB11 F2L(CTG)3+5+2+24188–191PET-CAGTTTCTGCGTGGAGGAATSharakov et al. [23]
AFUB11 RAGCAGCTGATGAGCCATCTC
AFND23 F2L(GT)1111133–1576-FAM-TTTGATCGACGGACTAGTGTGTSchemerhorn et al. [25]
AFND23 RGGTTTGATGGGTGGAAAC
FunO F2R(CA)6T(AC)410110–132PETGCACACATTTCAGGCAGCCohuet et al. [22]
FunO RGCCCACATTCTGCACCTT
AFUB3 F2R(CAG)2+3+25171–195VIC- GGGAAGGATTCGACCTTAGCSharakov et al. [23]
AFUB3 RGCCGCCATTTAGTAGCAGTT
FunF F3L(TG)97104–1186-FAM –GCCTTCAGTTTCGATTGGCGCohuet et al. [22]
FunF RAATAAGATGCGACCGTGGC
AFUB12 F3L(AGG)7(TG)43152–158VIC –TGGGGAACTGGTCGTTAGAGSharakov et al. [23]
AFUB12 RCTGGTGATGGGATTGAGGAT
AFND19 F3R(AG)12(TG)58251–285HEX –GCAAGCTGTACGCAGAGAGSharakov et al. [24]
AFND19 RATCGATGGGAGTTATTATACGC
AFND20 F3R(GAG)4+2+2+2(TGG)32239–242VIC- CGGCGCAGGTTTAGTAGCSharakov et al. [24]
AFND20 RCCCTCGCTTTCCTCATAAAA
AFND41 F3R(CA)3TC(CA)66222–2466-FAM AGAACATATGGCAAATCGACSchemerhorn et al. [25]
AFND41 RGAAAGACTTGTCGGACGTG
FunQ FX(TG)9784–98HEX –GCAAACTGCTAGTAAATGTTTCCCohuet et al. [22]
FunQ RACATTTCCACAATTTGCGC