Skip to main content

Table 2 Primer pairs used for detection or for the MLST of selected targets of Borrelia spp. in I. ricinus ticks

From: Borrelia miyamotoi and Borrelia burgdorferi (sensu lato) identification and survey of tick-borne encephalitis virus in ticks from north-eastern Germany

PathogenTargetPrimer/ProbeSequence (5′-3′)References
Borrelia spp.16S-23S rRNABospp-IGS-FGTATGTTTAGTGAGGGGGGTG[32]
Bospp-IGS-RGGATCATAGCTCAGGTGGTTAG
Bospp-IGS-FiAGGGGGGTGAAGTCGTAACAAG
Bospp-IGS-RiGTCTGATAAACCTGAGGTCGGA
B. miyamotoinifSBmnifF31GAAAAAGTAAACTCCCTCAGAAAGG[35]
BmnifR892CAATGATGCCTGCAATATTTGGTG
clpABmclpAF1268TTGATCTCTTAGATGATCTTGG[35]
BmclpAR2051CAAACATAAACCTTTTCAGCCTTTAATA
rlpBBmrplF18ATTAAGACTTATARGCCAAAAAC[35]
BmrplR761GGCTGNCCCCAAGGWGAT
pyrGBmpyrF415CTTYTAGTWATTGARATTGGTGGT[35]
BmpyrR1261CAGCATCAAYTATRCCACAAAC
recGBmrecF908CTAGYATTCCTYTAATTGAGGC[35]
BmrecR1779TTCRGTTAAAGGTTCCTTATAAAG
clpXBmclpXF104CTGTTGCYATTTGTTTTGAATGC(Y)TC[35]
BmclpXR1277TAAAGTTCTTTTGCCCAAGG
pepXBmpepXF361AGAGAYTTAAGYTTAKCAGG[35]
BmpepXR1202GTTTCTCTTAAAGAYTGCATTCC
uvrABmuvrF1435GCTKAAATTTTTRATTGATGTTGGA[35]
BmuvrR2306CARGGAACAAAAACATCRGGC
rplBaBmrplF23GACTTATAGGCCAAAAACTTC[35]
Bmrpl759RGATACAGGATGACGACCACC
pyrGaBmpyrF417TTTAGTAATTGAGATTGGTGGTAC[35]
Bmpyr1252RTATTCCACAAACATTACGAGC
recGaBmrecF909TAGCATTCCTTTAGTTGAGGC[35]
Bmrec1671RCTCAGCATGCTCAACTACC
clpXaBmclpF268TTATCTGTTGCTGTTTATAATC[35]
BmclpX1155RTTCAAACATAACATCTTTAAGTAATTCTTC
pepXaBmpepF361AGAGACTTAAATTTAGCAGGAGTTG[35]
Bmpep1187RTGCATTCCCCACATTGGAGTTC
uvrAaBmuvrF1437TTAAATTTTTAATTGATGTTGGACT[35]
Bmuvr2147RTCTGTAAAAAACCCAACATAAGTTGC
TBEV3′ non-coding regionF_TBE_1GGGCGGTTCTTGTTCTCC[36]
R_TBE_1ACACATCACCTCCTTGTCAGACT
TBE-probe-WTTGAGCCACCATCACCCAGACACA
  1. aSequencing primers used in the second round of amplification and for sequencing the PCR products