Skip to main content

Table 1 Primers and target genes of pathogens investigated

From: Ticks and associated pathogens in camels (Camelus dromedarius) from Riyadh Province, Saudi Arabia

PathogensPrimers (5′-3′)Target geneProduct size (bp)Cycling conditionsReference
Babesia spp./Theileria spp.RLBF: GAGGTAGTGACAAGAAATAACAATA18S rRNA46095 °C—600 s, 95 °C—30 s, 52 °C—30 s (× 40), 72 °C—60 s, 72 °C—420 s[35]
RLBR: TCTTCGATCCCCTAACTTTC
Babesia spp.PiroA: AATACCCAATCCTGACACAGGG18S rRNA41095 °C—600 s, 95 °C—30 s, 62 °C—30 s (× 35), 72 °C—30 s, 72 °C—420 s[36]
PiroB: TTAAATACGAATGCCCCCAAC
Hepatozoon canisHepF: ATACATGAGCAAAATCTCAAC18S rRNA62595 °C—600 s, 95 °C—30 s, 60 °C—30 s (× 35), 72 °C—60 s, 72 °C—300 s[37]
HepR: CTTATTATTCCATGCTGCAG
Ehrlichia spp./ Anaplasma spp.EHR16SD: GGTACCYACAGAAGAAGTCC16S rRNA34595 °C—120 s, 94 °C—60 s, 54 °C—30 s (× 40), 72 °C—30 s, 72 °C—300 s[38]
EHR16SR: TAGCACTCATCGTTTACAGC