Skip to main content

Advertisement

Table 1 Primers and PCR amplification conditions

From: Identification and evaluation of UL36 protein from Dermacentor silvarum salivary gland and its interaction with Anaplasma ovis VirB10

Primer namePrimer sequence (5′-3′)Annealing temperature (°C)Amplicon size (bp)
VB10otFAATTCCATATGATGTCAGACGAAACCAAGGATAAC581326
VB10otRTCGACGTCGACCTACCTCCGCACCGCCTC
V10-32FCGCGGATCCATGTCAGACGAAACCAAGGATAA581340
V10-32RAGAATGCGGCCGCCTACCTCCGCACCGCCTC
S41-FCGCGGATCCATGCGCCGCCACAAGGGT63.51139
S41-RATTTGCGGCCGCTCAGCGGCGGCGGATGAG
  1. Note: The bold letters indicate the inserted enzyme restriction sites