Skip to main content

Advertisement

Table 4 Polymorphisms in codon 198 in isotype 1 β-tubulin gene of Haemonchus contortus collected in different areas in the States South, Central and East Darfur in Sudan detected by Sanger sequencing

From: New codon 198 β-tubulin polymorphisms in highly benzimidazole resistant Haemonchus contortus from goats in three different states in Sudan

StateAreaSample sourceSample typeaTreatmentbncNo. of samples with each variant
GAAGCATTAGTAAAAATATAA
South DarfurBuramAbattoirAdultna111090001
KassTrialsL310010000
+70070000
Adult+30030000
AbattoirAdultna90081000
NyalaTrialsL341030000
+40040000
Adult+30030000
AbattoirAdultna2020134100
Rehed Al-BirdiTrialsL383050000
+70070000
Adult+20020000
AbattoirAdultna83041000
TulusTrialsL321010000
+30030000
Adult+40040000
AbattoirAdultna133080011
Um DafuqTrialsAdult+20020000
Central DarfurZalingeiAbattoirAdultna1100110000
East DarfurEd DaeinAbattoirAdultna1100110000
Total (and %)13314 (10.5)0 (0)109 (82)6 (4.5)1 (0.8)1 (0.8)2 (1.5)
  1. aPools of third-stage larvae (L3) (at least ~ 1000 nematode L3/sample) or of adults (trials: 11–84, abattoirs: 10–97 adult male H. contortus/sample)
  2. bThird-stage larval samples (L3): (−) faecal samples collected on day 0; (+) the samples collected 10 days after treatment with albendazole at different doses: 5 or 10 mg/kg body weight (bw) (all study areas), and additionally 7.5 or 12.5 mg/kg bw in trials of Rehed Al-Birdi. Adult male H. contortus: samples isolated from goats slaughtered on day 14 after treatment with 5 or 10 mg/kg bw albendazole (+)
  3. cNumber of pools tested
  4. Abbreviation: na, the situation of anthelmintic treatments was unknown, since adult male H. contortus isolated from goat abomasa at abattoirs