Skip to main content

Advertisement

Table 1 Primers and probes for the qPCR method for three vertebrate host species

From: Probe-based multiplex qPCR identifies blood-meal hosts in Anopheles mosquitoes from Papua New Guinea

OrganismPrimer/probe nameNucleotide sequence (5′-3′)Amplicon size (bp)
HumanhumanTH1_FGGCCTGTTCCTCCCTTATTT101a
humanTH1_RTACACAGGGCTTCCGAGT
humanTH1_PFAM-ATGGAGTCTGTGTTCCCTGTGACC-QSY
PigpigCOX1_FCTGACTACTTCCACCATCCTTC108
pigCOX1_RTGGGCTAAGTTTCCAGCTAAA
pigCOX1_PVIC-ATAGTAGAAGCCGGAGCGGGTACT-QSY
DogdogCYTB_FTGGACAAAGCAACCCTAACA103
dogCYTB_RCCGGTTTCGTGTAGAAATAGGA
dogCYTB_PABY-TCATCCTCCCTTTCATCATCGCAGC-QSY
  1. aDue to presence of a microsatellite repeat sequence (5′-AATG-3′) within the human amplicon, the PCR product size varies between different human individuals. Presence of the repeat sequence does not affect PCR amplification as the primers and probe sequence do not extend into the repeat region