Skip to main content

Table 2 Target genes and primers used for PCR to detect Babesia spp., Borrelia persica, Hepatozoon canis, Ehrlichia canis and Ornithodoros tholozani in this study

From: A new piroplasmid species infecting dogs: morphological and molecular characterization and pathogeny of Babesia negevi n. sp.

Target organism and genePrimerPrimer sequence (5′-3′)Reference
Babesia 18S rRNAPiroplasmidFCCAGCAGCCGCGGTAATT[11]
PiroplasmidRCTTTCGCAGTAGTTYGTCTTTAACAAATCT
522FGTTGATCCTGCCAGTAGT[12]
1661RAACCTTGTTACGACTTCT
Fragment1FGTTGATCCTGCCAGTAGTThis study
Fragment1RCTGGAAAAAGAGAGCCGA
Fragment2FTGTAATTGGAATGATGGGAATC
Fragment2RAACCTTGTTACGACTTCTC
AdditionalFTTCCGTTAACGAACGAGACC
AdditionalRTTATAGTTAGGACTACGACGG
Babesia cox1COX1FGGAAGTGGWACWGGWTGGAC[13]
COX1RTTCGGTATTGCATGCCTTG
Borrelia spp. flabBfpbuGCT GAA GAG CTTGGAATGCAACC[14]
BfpcrTGATCAGTTATCATTCTAATAGCA
Hepatozoon spp.Hepatozoon 18S-FGGTAATTCTAGAGCTAATACATGAGC[16]
Hepatozoon 18S-RACAATAAAGTAAAAAACAYTTCAAAG
Ehrlichia spp. 16S rRNAEHR16SDGGTACCYACAGAAGAAGTCC[15]
EHR16SRTAGCACTCATCGTTTACAGC
Tick 16S rRNA16S+1CTGCTCAATGATTTTTTAAATTGCTGTGG[17]
16S−1CCGGTCTGAACTCAGATCAAGT