Skip to main content

Table 2 Brief information about PCR in this study

From: A survey of insecticide resistance-conferring mutations in multiple targets in Anopheles sinensis populations across Sichuan, China

Name Sequence (5′–-3′) Annealing temperature (°C) Amplicon size References
ASACE-F TAATGATCCGCTGGTGGTGA 60  ~ 790 bp ATLV01007054.1
ASACE-R TACCGGAGAGTTGCTTCCTC  
ASKDR-F TGCCACTCCGTGTGTTTAGA 55  ~ 325 bp Zhong et al. 2013
ASKDR-R GAGCGATGATGATCCGAAAT  
ASRDL-F AGTTTGTACGTTCGATGGGTTA 62  ~ 476 bp KE525297.1
ASRDL-R GGCAACAGTAAGCTATGTCGA