Skip to main content

Table 1 Oligonucleotide primers that were used to perform PCR in this study to detect the molecular targets in Rickettsia species

From: First report of the molecular detection of human pathogen Rickettsia raoultii in ticks from the Republic of Korea

Target Primer Nucleotide sequence (5′–3′) Fragment length Reference
ompA RR190.70F ATGGCGAATATTTCTCCAAAAA 634 bp (first) [12]
RR190.701R GTTCCGTTAATGGCAGCATCT
RR190.70F ATGGCGAATATTTCTCCAAAAA 535 bp (nested)
RR190.602R AGTGCAGCATTCGCTCCCCCT
gltA GLTA1F GACGGTGATAAAGGAATCTTG 1022 bp (first) [13]
GLTA1R CATTTCTTTCCATTGTGCCATC
GLTA2F CTACGAACTTACCGCTATTAG 446 bp (nested)
GLTA2R GACCAAAACCCATTAACCTAAAC