Skip to main content

Table 1 Target genes and primer sequences used for nested PCR

From: Identification of tick-borne pathogens by metagenomic next-generation sequencing in Dermacentor nuttalli and Ixodes persulcatus in Inner Mongolia, China

Pathogen Target gene Primer name Sequence (5′–3′) Tm (T/℃)
SFGR gltA CS2d ATGACCAATGAAAATAATAAT 50
   CSEndr CTTATACTCTCTATGTACA  
   RpCS.877p GGGGACCTGCTCACGGCGG 48
   RpCS.1258n ATTGCAAAAAGTACAGTGAACA  
Anaplasma spp. 16S rRNA Eh-out1 TTGAGAGTTTGATCCTGGCTCAGAACG 55
Ehrlichia spp.   Eh-out2 CACCTCTACACTAGGAATTCCGCTATC  
   Eh-gs1 GTAATAACTGTATAATCCCTG 55
   Eh-gs2 GTACCGTCATTATCTTCCCTA  
Coxiella spp. 16S rRNA Cox16SF1 CGTAGGAATCTACCTTRTAGWGG 55
   Cox16SR2 GCCTACCCGCTTCTGGTACAATT  
   Cox16SF1 CGTAGGAATCTACCTTRTAGWGG 55
   Cox16SR1 ACTYYCCAACAGCTAGTTCTCA  
Babesia spp. 18S rRNA Piro0F GCCAGTAGTCATATGCTTGTGTTA 56
   Piro6R CTCCTTCCTYTAAGTGATAAGGTTCAC  
   Piro1F CCATGCATGTCTWAGTAYAARCTTTTA 56
   Piro5.5R CCTYTAAGTGATAAGGTTCACAAAACTT