Skip to main content

Table 1 Sequences of primers used for qRT-PCR

From: lncRNA028466 regulates Th1/Th2 cytokine expression and associates with Echinococcus granulosus antigen P29 immunity

Gene primer(5′ → 3′)
lncRNA 028466 F: AGGCCCAGTCTCTCTTGTGA
R: GGGTCTGATGGGTCTCAT
IL-2 F: TGAGCAGGATGGAGAATTACAGG
R: GTCCAAGTTCATCTTCTAGGCAC
IFN-γ F: CTCCCGTGGCTTCTAGTGC
R: GCCTTAGTTTGGACAGGATCTG
IL-4 F: ATCATCGGCATTTTGAACGAGG
R: TGCAGCTCCATGAGAACACTA
IL-10 F: GCCACGGCACAGTCATTGA
R: TGCTGATGGCCTGATTGTCTT
GAPDH F: AGGTCGGTGTGAACGGATTTG
R: GGGGTCGTTGATGGCAACA