Skip to main content

Table 1 Primers and PCR conditions

From: Correction to: First multilocus sequence typing (MLST) of Giardia duodenalis isolates from humans in Romania

Gene PCR reaction Product length (bp) Primer name Primer (5'-3') PCR conditions References
bg 1st 753 G7 AAGCCCGACGACCTCACCCGCAGTGC A [37]
G759 GAGGCCGCCCTGGATCTTCGAGACGAC
2nd 511 B-F GAACGAACGAGATCGAGGTCCG B
B-R CTCGACGAGCTTCGTGTT
gdh 1st n.g GDHeF TCAACGTYAAYCGYGGYTTCCGT A [37]
GDHeR GTTRTCCTTGCACATCTCC
2nd 432 GDHiF CAGTACAACTCYGCTCTCGG C
   GDHiR GTTRTCCTTGCACATCTCC
ITS1 1st 347 FW1 TGGAGGAAGGAGAAGTCGTAAC D [16]
RV1 GGGCGTACTGATATGCTTAAGT
2nd 315 FW2 AAGGTATCCGTAGGTGAACCTG
  RV2 ATATGCTTAAGTTCCGCCCGTC
tpi 1st 605 ALA3542 AAATIATGCCTGCTCGTCG A [38]
ALA3542 CAAACCTTITCCGCAAACC
2nd 530 ALA3544 CCCTTCATCGGIGGTAACTT
  ALA3545 GTGGCCACCACICCCGTGCC
  1. PCR conditions: A (1 cycle: 95 °C for 5 min; 40 cycles: 95 °C for 45 s, 50 °C for 30 s, 72 °C for 60 s; 1 cycle: 72 °C for 7 min); B (1 cycle: 95 °C for 5 min; 35 cycles: 95 °C for 45 s, 55 °C for 30 s, 72 °C for 45 s; 1 cycle: 72 °C for 7 min); C (1 cycle: 95 °C for 5 min; 40 cycles: 95 °C for 45 s, 60 °C for 30 s, 72 °C for 45 s; 1 cycle: 72 °C for 7 min); D (1 cycle: 95 °C for 5 min; 35 cycles: 95 °C for 30 s, 59 °C for 30 s, 72 °C for 30 s; 1 cycle: 72 °C for 7 min)