Skip to main content

Table 1 List of primers used for the amplification of target genes of ticks and Rickettsia spp.

From: Risk factors associated with tick infestations on equids in Khyber Pakhtunkhwa, Pakistan, with notes on Rickettsia massiliae detection

Organism/gene Primer Primers sequences (5′–3′) Product size (bp) References
Tick 16S rRNA 16S + 1 CCGGTCTGAACTCAGATCAAGT 460 [22]
16S − 1 GCTCAATGATTTTTTAAATTGCTG
Rickettsia spp./gltA CS-5a GAGAGAAAATTATATCCAAATGTTGAT 147 [2]
CS-6a AGGGTCTTCGTGCATTTCTT
Rickettsia spp./gltA CS-78 GCAAGTATCGGTGAGGATGTAAT 401 [2]
CS-323 GCTTCCTAAAATTCAATAAATCAGGAT
Rickettsia spp./ompA Rr190.70 ATGGCGAATATTTCTCCAAAA 532 [24]
Rr190.701 GTTCCGTTAATGGCAGCATCT
  1. gltA Rickettsial citrate synthase-encoding gene, ompA rickettsial outer membrane protein A
  2. aThese primers were used in a real-time PCR assay with the following internal probe: 5′ 6-FAM CAT TGT GCC ATC CAG CCT ACG GT- BHQ-1 3′