Skip to main content

Table 1 Primers and PCR cycling programmes

From: Soil-transmitted helminth infections in free-ranging non-human primates from Cameroon and Gabon

Target organism Gene Primer Sequence (5'–3') Product size (bp) Thermal profilea
Step 1 Step 2 Step3 N
Temperature (°C) Duration (s) Temperature (°C) Duration (s) Temperature (°C) Duration (s)
Oesophagostomum/Necator ITS2 NC1 ACGTCTGGTTCAGGGTTGTT NA 94 30 50 30 72 45 45
NC2 TTAGTTTCTTTTCCTCCGCT
OesophITS2 TGTRACACTGTTTGTC-GAAC 250/300 94 30 55 30 72 30 35
NC2 TTAGTTTCTTTTCCTCCGCT
Trichuris trichiura ITS2 ExtITS2 GGATCACTTGGCTGGTAG NA 94 30 56 30 72 45 45
NC2 TTAGTTTCTTTTCCTCCGCT
IntITS2 CTTGAATACTTTGAACGCACATTG 480–700 94 30 49 30 72 45 35
NC2 TTAGTTTCTTTTCCTCCGCT
Ascaris lumbricoides ITS1 ITS F1 CGAGCAGAAAAAAAAAAGTCTCC NA 94 30 50 45 72 45 45
ITS R1 GGAATGAACCCGATGGCGCAAT
ITS F2 CGAGCAGAAAAAAAAAAAAGTCTCC  ~ 500 94 30 52 30 72 30 35
ITS R2 GCTGCGTTCTTCATCGAT
  1. ITS Internal transcribed spacer, N number of cycles, NA data not available
  2. All PCR analyses started with 95 °C for 15 min and finished with 72 °C for 10 min
  3. aStep 1: denaturation; Step 2: annealing; Step 3: elongation