Skip to main content

Table 2 Universal forward primer sequences and specific reverse primer sequences for the six species of mosquitoes assayed in this study

From: A multiplex PCR assay for six Aedini species, including Aedes albopictus

Species Forward primer (5′→3′) Reverse primer (5′→3′) Product length (bp)
Aedes flavopictus AGGACACATGAACACCCACA TGAGGCCTACTGACTTGACTTG 495
Aedes albopictus   GGAGCACACTGAGAGTTCCA 438
Ochlerotatus koreicus   GCCTACTGATTGACGGGGTA 361
Ochlerotatus togoi   AGGCGGTGGAGTGTATGG 283
Ochlerotatus hatorii   CAATGTTTTACCGCTGTTTGC 220
Ochlerotatus japonicus   TATACTACGCTGCCGAGAGG 160