Skip to main content

Table 1 The primers used in the present study.

From: MicroRNA-497 induced by Clonorchis sinensis enhances the TGF-β/Smad signaling pathway to promote hepatic fibrosis by targeting Smad7

Target Oligonucleotide sequence (5'–3′)
Forward primer Reverse primer
Has-β-actin GCCCTGAGGCACTCTTCCA TTGCGGATGTCCACGTCA
Has-Col1a1 ACTGGTGAGACCTGCGTGTA AATCCATCGGTCATGCTCTC
Has-Smad7 CCCCATCACCTTAGCCGACTCTGC CCCAGGGGCCAGATAATT
Has-miR-497 CAGCAGCACACTGTGGTTTG  
Has-Acta2 TTCATCGGGATGGAGTCTGCTGG TCGGTCGGCAATGCCAGGGT
U6 ATGGGTCGAAGTCGTAGCC TTCTCGGCGTCTTCTTTCTCG
mmu-miR-497 CAGCAGCACACTGTGGTTTGTA  
mmu-Smad7 AGAGGCTGTGTTGCTGTGAATC CCATTGGGTATCTGGAGTAAGGA
mmu-β-actin AACTCCATCATGAAGTGTGA ACTCCTGCTTGCTGATCCAC
mmu-Col1a1 TAGGCCATTGTGTATGCAGC ACATGTTCAGCTTTGTGGACC