Skip to main content

Table 1 Primer sequences and product length of the candidate genes and housekeeping genes

From: Use of transcriptional age grading technique to determine the chronological age of Sri Lankan Aedes aegypti and Aedes albopictus females

Gene name Aedes aegypti
(Primer 5’-3’)
Product length (bp) Aedes albopictus
(Primer 5’-3’)
Product length (bp)
Ae 15848 F- CGAAGAGTTCAAGGATGCCG
R- TCTATGCTGACCAGACCGTC
135 F- GATGAGATCTCTGCCCTTGC
R-TCGGAGTAGGACTTGCCAAC
103
Ae 8505 F- ATCATCTGCCAACTCCACCA
R- ATCCGGCAGTCAGAGTGAAA
115 F- CGCTCAAGATAGCAACATCG
R- TATGATGACGTCGCTGGTGT
130
Ae 4274 F- GGACGCTTAGCGGGAAGAC
R- TTGGCGTTTGGGATTTACCT
81 F- GCCCGATATCATCAACGACT
R- CCCTCCTTCGTTCTCGTACA
142
RSp17 F- GCAGCTGGACTTCAACAACA
R- AACAACATCCCAACTGCACC
139 F- CAGGTCCGTGGTATCTCCAT
R- TCCACTTCGATGATGTCCTG
104
  1. F forward, R reverse