Skip to main content

Table 2 Overview of primers and probes used for the in-house qPCR-screenings of three pathogenic agents

From: A community approach of pathogens and their arthropod vectors (ticks and fleas) in dogs of African Sub-Sahara

Target In-house forward primer In-house reverse primer In-house hydrolysis probe
Hepatozoon canis GGCAGTGACGGTTAACGGGGG GCACCAGACTTGCCCTCCAATTG CCGGAGAGGGAGCCTGAGAAACGG
Dirofilaria immitis    CTTTGGAATATGTGTTTTTTTGGAGAGCCCTC
Babesia felis AAGAAGCTCGTAGTTGAATTTCTGCC GAGAAGCCGAAGCAACACAAATCCAG TGCGTTTTCCGACTGGCTTGGCA
  1. For all PCRs, the final forward and an reverse primer concentrations were 400 nM. The final probe concentration was 200 nM