Skip to main content

Table 1 Details of designed primers for Candidatus Riesia pediculicola gene amplification

From: Phylogenetic relationship between the endosymbiont “Candidatus Riesia pediculicola” and its human louse host

Endosymbiont of Pediculus humanus Target gene Primer sequences (5′–3′) Tm Fragment length (bp)
Candidatus Riesia pediculicola ftsZ ftsZ-196F_GGGAATTTCTGATCTTCTTCTGCG 56 °C 454
ftsZ-650R_CTTTACTGGATGCTTTTGGYGC
groEL groEL-560F_GATAGAGGTTATCTGTCTCC 50 °C 631
groEL-1191R_GCAGCTCKAGTAGCATGTA
rpoB rpoB-865F_ACCTGGTGATAAATCGTCTCC 54 °C 677
rpoB-1542R_GAAAGAATCGTTCAGAAAGATCGG
rpoB-2619F_CAGCCATCTCTCCGATTGAACG 56 °C 466
rpoB-3085R_CGATGGAAAGCTAATTTGTTCAGC
  1. Tm, Melting temperature