Skip to main content

Table 1 Details of the PCR primers used in the present study, with the respective positive control DNA used in the reactions

From: Novel genotypes of Hepatozoon spp. in small mammals, Brazil

Genes Target organisms Primers Sequence (5′–3′) Amplicon size (bp) References Positive control in the PCR assay
18S rRNA Hepatozoon spp. HEP2 144–169 (F) GGTAATTCTAGAGCTAATACATGAGC 574 [41] Hepatozoon canis
   HEP2 743–718 (R) ACAATAAAGTAAAAAACAYTTCAAAG    
   HAM-1(F) GCCAGTAGTCATATGCTTGTC 1750 [42] H. canis
   HPF-2(R) GACTTCTCCTTCGTCTAAG    
   HEP-1(F) CGCGAAATTACCCAATTa    
   HEP-2(R) CAGACCGGTTACTTTYAGCAGa    
   HEP-4(R) TAAGGTGCTGAAGGAGTCGTTTATa    
   HPF-1(F) CTATGCCGACTAGAGATTGa    
18S rRNA Piroplasmorida BAB2 143–167 (F) CCGTGCTAATTGTAGGGCTAATACA 551 [41] Babesia vogeli
   BAB2 694–667 (R) GCTTGAAACACTCTARTTTTCTCAAAG    
16S rRNA Anaplasmataceae EHR 16SD (F) GGTACCYACAGAAGAAGTCC 344 [43] Ehrlichia canis
   EHR 16SD (R) TAGCACTCATCGTTTACAG    
  1. aInternal primers used only for DNA sequencing