Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 2 Gene specific primers used for RT-PCR expression profiling of I. ricinus peptidases

From: Profiling of proteolytic enzymes in the gut of the tick Ixodes ricinus reveals an evolutionarily conserved network of aspartic and cysteine peptidases

peptidase forward primer reverse primer annealing temperature product length
IrAE 5'TCGGTGACGCTGAGAAGACTGAA3' 5'TAGATTATGCCCGATGACTGTTGG3' 55°C 239 bp
IrCB 5'CGACGGCGGATACCCGGCGGCAGC3' 5'CCGAGTACGTCACCGCTGTGGTGC3' 60°C 360 bp
IrCL 5'GTCACGCCCGTCAAGAACC3' 5'TGGCATCAATGGCAACAGAGA3' 62°C 382 bp
IrCC 5'CCACCCGGGACCCCTACAACACC3' 5'GGAAGCCGCCCTCGCAACC3' 68°C 447 bp
IrCD 5'GGACCCCGCCCCAAGACT3' 5'CGATGCCGCCGAACAGGA3' 61°C 459 bp