Skip to main content

Advertisement

Table 1 Primer sequences for dsRNA construction (DS-) and RT-PCR (RT-)

From: Inhibition of trypsin expression in Lutzomyia longipalpis using RNAi enhances the survival of Leishmania

Primer 5'-3' sequence Size (bp)
DS-Trypsin 1 F TAATACGACTCACTATAGGGAGAGTCTTCACCGCTGCCCATTG 551
DS-Trypsin 1 R TAATACGACTCACTATAGGGAGATCGCGAACGGAAGAAACACG  
DS-AMP F TAATACGACTCACTATAGGGATGCCGGGAAGCTAGAGTAAGTA 534
DS-AMP R TAATACGACTCACTATAGGGAAACGCTGGTGAAAGTAAAAGATG  
RT-Trypsin 1 F GTCTTCACCGCTGCCCATTG 423
RT-Trypsin 1 R GTCCTTGCCGCCCTCTTCA  
RT-Trypsin 2 F GGAGGCAAGCCCGTGAGCATC 553
RT-Trypsin 2 R CAACGACGGGACCGCCAGAAT  
RT-Lulong 60S L3 F TCTCATCGGAAGTTTTCTGC 850
RT-Lulong 60S L3 R GGCTTGTGACACCCTTGAAT