Skip to main content

Table 1 Primers used for the validation of microarray data by quantitative qPCR analysis

From: Differential gene expression in Schistosoma japonicum schistosomula from Wistar rats and BALB/c mice

Systematic Name Protein Homology   sequences
Contig05321 Outer membrane protein Forward CAAGGTCCTGAAACGTGAAAC
Contig03467 Arginine kinase Forward CGGTCGTCGTTTGTTTCTTC
Contig07888 Growth hormone-inducible transmembrane protein Forward GTGTGTCGATTAATGCTCAGTG
Contig02569 Cell differentiation protein Forward GGGCGGAATAGAAGGAAACC
Contig00624 14-3-3-like protein 2 Forward CTTAACACCGAAGTCCAATGG
Contig00468 Oxidoreductase HTATIP2 Forward AAAGCCTTAATCAAAGCCCTTG
Contig04397 NADH-ubiquinone reductase Forward CGAGGACCTAACAGCAGAGG