Skip to main content

Table 3 Primers used for the PCRs for sequence analysis for Anaplasma phagocytophilum from horses in this study.

From: Genetic variants of Anaplasma phagocytophilum from 14 equine granulocytic anaplasmosis cases

Target Gene Primers 5'-3' Cycle conditions ** Reference
16S rRNA First reaction:
ge3a: CACATGCAAGTCGAACGGATTATTC
ge10r: TTCCGTTAAGAAGGATCTAATCTCC
Nested reaction*:
ge9f: AACGGATTATTCTTTATAGCTTGCT
ge2: GGCAGTATTAAAAGCAGCTCCAGG
40 cycles (nested reaction: 25 cycles):
30 sec 94°C, 30 sec 55°C, 1 min 72°C
[42]
groEL First reaction:
EphplgroEL-F: ATGGTATGCAGTTTGATCGC
EphplgroEL-R: TCTACTCTGTCTTTGCGTTC
Nested reaction*:
EphplgroEL-F: ATGGTATGCAGTTTGATCGC
EphgroEL-R: TTGAGTACAGCAACACCACCGGAA
40 cycles:
30 sec 94°C, 30 sec 55°C, 45 sec 72°C
[28]
Msp2 msp25: TTATGATTAGGCCTTTGGGCATG*
msp23:TCAGAAAGATACACGTGCGCCC*
35 cycles:
1 min 95°C, 1 min 62°C, 1.5 min 72°C
[43]
Msp4 First reaction:
MSP4AP5: ATGAATTACAGAGAATTGCTTGTAGG
MSP4AP3: TTAATTGAAAGCAAATCTTGCTCCTATG
40 cycles:
30 sec 94°C, 45 sec 54°C, 1 min 72°C
[30]
  Nested reaction*:
msp4f: CTATTGGYGGNGCYAGAGT
msp4r: GTTCATCGAAAATTCCGTGGTA
  [44]
  1. * Primers used for the sequencing reactions
  2. ** all PCR reactions: 15 min 95°C initial activation; 7 min 72°C final extension