Skip to main content

Advertisement

Table 2 Primers designed and suggested to amplify repeat sequence (SSRs) including number of repeats product size in bp, forward (Fw-) and reverse (Rv-) primer sequences, and melting temperature (Tm).

From: Characterization of simple sequence repeats (SSRs) from Phlebotomus papatasi (Diptera: Psychodidae) expressed sequence tags (ESTs)

Name Accession no. SSR Product size Fw-Primer (5'-3') Tm (°C) Rv-Primer (5'-3') Tm (°C)
PPEST1 EY218895.1 (CA)15 170 AGTTCCGCCACATCCATTC 60.9 TTAGACAGCGGGAAAGAAGAAA 60.4
PPEST 2 FG108562.1 (GCA)13 141 TGTCAATAGTGGCTCAATGCTC 60.3 ATTAGTCGTTTATCCTTCCCCG 60.5
PPEST 3 EX474573.1 (TA)13 188 CAATTTTATGCGGTCTATGGGA 61.0 AGGTATGCAAAGTAATGGGTGG 60.1
PPEST 4 FG116618.1 (TC)13 197 ACCCGACGCGAATTTACTTT 60.8 GGAGAGACAAGTTATGGGGTCA 60.4
PPEST 5 FG107376.1 (TGC)13 190 GAGAGACATGGTGGATGGACTT 60.4 TGTCAATAGTGGCTCAATGCTC 60.3
PPEST 6 FG108078.1 (AT)12 291 AAATCCACTATCCTCCTTTCCTC 59.0 TTTTGGGGTAAGATGGGG 58.2
PPEST 7 EX473561.1 (CA)12 245 GTACCCTTTCCCTCCCTATGTC 60.1 GGGTTCACCAACATCCTCC 60.2
PPEST 8 FG119248.1 (CA)12 140 CCACTGTAACTTGAGGAGGAGG 60.2 AGACTTGATGAGTGCGTCTCTG 59.7
PPEST 9 FG117610.1 (CA)12 175 CGCACAAGAACAAAGTGGAAA 61.2 TCTTCTCGCTCCCTCGTTC 60.6
PPEST 10 FG117371.1 (TC)12 236 ACTGAATCTTCTGCTTTCTCCATTC 61.4 TAAGGGAAGGGGCGGAAC 62.2
PPEST 11 ES347986.1 (GA)11 162 GGTGGATACTTGTGACGACTGA 60.0 CCACTCAAACTAAACTGGAAAGC 59.4
PPEST 12 FG113351.1 (AT)10 233 CTTTTCTGCCTTAGCTGCGTT 61.0 CGTGTCTCTTCCACCACTACAA 60.2
PPEST 13 EY206382.1 (TC)10 222 AGCTGGAATCAGGAGCAAAT 58.9 CAGTATCAAGCGAAAGCCG 59.6
PPEST 14 FK815057.1 (GA)9 228 ACGTGTTGTTTTCTGTGGAGTG 60.1 CTGGGTATTTTCTGCCTTGATT 59.5
PPEST 15 FK812013.1 (TGA)9 157 AAGAAAGGTTTGGCTTCGTGT 60.2 AATGGTGCTTCATCTCCTCTTC 59.7
PPEST 16 FK811085.1 (TCA)9 239 TTCTGTTCACACATCATTTCCC 59.8 TGTGGCTGTAATTTGACTGGAG 60.2
PPEST 17 FG116712.1 (TGC)9 208 CTGTTCAGCAAAACGAGACG 59.6 TCCCAAGTACAAAGACGGAACT 60.0
PPEST 18 EY216123.1 (CT)9 276 ACTTGCATACTCTTTCGCACAA 59.9 AAATTCATGGAAAACCTCCCTC 60.5
PPEST 19 EY210796.1 (AC)9 211 ACCCATCACCGTCTCTGC 59.6 TTTCCCTTGAACAACAACCAC 59.9
PPEST 20 EY210288.1 (TC)9 293 ACAGAAGAAACCATCCATTTGC 60.4 CCATATTCCCGATTGAGAGAGA 60.4
PPEST 21 EX474074.1 (AG)9 244 GGATTAGTGTGGCTCAAGATGG 60.9 GCAGGAAAATAGCAAAAGGGAT 60.8
PPEST 22 ES347170.1 (GT)9 229 ATGGGGTATTAAGGGAGAATGC 60.4 GGGACGTGTGTGAGTGAGATAG 59.6
PPEST 23 FG120710.1 (GA)8 223 CTGCATTTCTAATTTCGCGG 60.7 GGAGGAAGTGGACAGTGAAAAC 60.0
PPEST 24 FG118096.1 (TC)8 129 AGGCACATTTTGGTTGTCTTCT 60.0 ATTTAGGGAGTCAATAGCGCAG 59.8
PPEST 25 EY218678.1 (TTTA)8 132 CCATTCACTTCAAATCCATCCT 60.2 AACTGGGTGGTTGGTTGTTTT 60.5
PPEST 26 EY216313.1 (AC)8 217 GATTCCCCAGGCAAAATAAA 58.9 TAATCAATATGGTGGGTTCCG 59.5
PPEST 27 EY213284.1 (TAAA)8 150 TTGCTAAAGACAAGCGCAACT 60.2 CCATTCACTTCAAATCCATCCT 60.2
PPEST 28 EY209870.1 (CAA)8 245 GATCAAGGCGGTTAATTTCAAG 60.0 ACAATCCAGAAGGACGATGC 60.1
PPEST 29 FK814636.1 (GGT)6 228 TTTGTGGAGTTCGATGACTACG 60.2 GGACACATTCCTGTTCCAATTC 60.6
PPEST 30 EY218675.1 (CT)9 373 TTCGCTCTTTCTCTCTCTCTCC 59.5 ATTCTGTACGTTACCTGCCCTG 60.4
PPEST 31 EY215872.1 (TA)11 400 AAACGTGCATTCTCTGCCTAAT 60.2 CTCGATATTTATTTCCCCGCT 59.5
PPEST 32 EY210648.1 (TTTA)6 123 ATTCACTTCAAACCCCTCCTTT 60.2 AACTGGGTGGTTGGTTGTTTT 60.5
PPEST 33 FG115100.1 (GAA)15 251 ATACTCCCTCAGAACTAGCCCC 60.0 TTCGTCTTCTTCTTCTTCCTCC 59.1
PPEST 34 EY215687.1 (AAAG)5 137 CACCTACAGAGATGCTGGATTG 59.8 GGGCTAAAATGTGTCTTGACTTG 60.0
PPEST 35 EY214242.1 (GT)15 245 TAGTCACAACACACGAACCACA 60.1 TTAACCGTGAGAGTACCAGCAA 59.8
PPEST 36 EY203279.1 (TTTA)6 123 ATTCACTTCAAACCCCTCCTTT 60.2 AACTGGGTGGTTGGTTGTTTT 60.5
PPEST 37 EX474189.1 (AT)7 208 ACCGTGCAACCATTTTAAGTTC 60.3 AGTTATTCTTCTTCTTACTGCGCC 59.5
PPEST 38 FK811878.1 (AG)5 256 TCCAGATACTCAAGTTCCAGCC 60.6 TATAGCGTTCAGATCCACCAGA 59.7
PPEST 39 FG107375.1 (CT)6 292 CCCCAAAGAGAGTACACCAAAG 60.0 ATCAGCCAGTGTCGTATGAATG 60.0
PPEST 40 FG114532.1 (AG)5 322 TCCCAAGGCTATTAAGTCTGGT 59.2 GGCTATCGTGCAATTTTCTTCT 59.8