Skip to main content

Table 1 Primers designed for the microsatellite loci using the An. nili genome sequence.

From: Improving the population genetics toolbox for the study of the African malaria vector Anopheles nili: microsatellite mapping to chromosomes

Locus Forward primer Reverse primer Size of PCR product
B115 CACGCTGGCTAAGAGGAAAC CTGGTCTCTAGCACCCGAAG 559 bp
2C157 GAGAGCGGCTGTTCGTAATC CGGACTGGCGAAATAAACAT 506 bp
A154 CACAGGGACGCCTAAAACAT GACCCGCGTAACTAGGGAAT 537 bp