Figure 3From: Efficient in vitro RNA interference and immunofluorescence-based phenotype analysis in a human parasitic nematode, Brugia malayiRNAi against ajm-1 in B. malayi early embryos. Stained embryos from control Lit28i hsiRNA-treated (A) or ajm-1 hsiRNA-treated (B, C) worms are shown. RNAi control 1.5 fold embryo (A). For comparison, a 1.5 fold embryo displaying morphogenesis defects as a result of loss of AJM-1 (B). The extruded cells (arrows) indicate a compromised junctional integrity of the epidermis. A cluster of late-stage embryos extracted from a uterine fragment, showing robust and consistent phenotypes of cell extrusion and elongation defects (C). Staining with propidium iodide (red) and phalloidin (green) indicate DNA and actin, respectively. A 442 bp fragment of the B. malayi ajm-1 cDNA was amplified with primers: ajmF- 5'-TAATACGACTCACTATAG GGGAACGACTATATGTACGGTG -3' and ajmR 5'-TAATACGACTCACTATAG GGGATCATATTGACGACACAGAG -3' where the T7 promoter sequence is underlined and followed by a GG nucleotide (see Methods). An annealing temperature of 60°C was used in the PCR. The cDNA fragment was transcribed and RNA diced to hsiRNA as described. Adult females were soaked for 2 days in 1 μM ajm-1 hsiRNA and tissues fixed on the third day. Control females were kept in the same conditions and included worms cultured without hsiRNA or with a comparable concentration of Lit28i polylinker ShortCut siRNA mix.Back to article page