Table 1 PCR primer sets for amplification of SSU rRNA region of Blastocystis from dog faeces
From: Diversity of Blastocystis subtypes in dogs in different geographical settings
Primer | Primer name and sequence (5′ to 3′) | Product size |
|---|---|---|
Single step PCR conditions as per Scicluna et al. [14] | BhRDr -GAGCTTTTTAACTGCAACAACG | 600 bp |
RD5 –ATCTGGTTGATCCTGCCAGT | ||
Nested PCR–primary set, conditions as per Clark [13] | RD3-GGGATCCTGATCCTTCCGCAGGTTCACCTAC | 1800 bp |
RD5 -GGAAGCTTATCTGGTTGATCCTGCCAGTA | ||
Nested PCR – secondary set, conditions as per Bohm-Gloning [15], using 1 ul of PCR product from primary step. | Forward -GGAGGTAGTGACAATAAATC | 1100 bp |
Reverse - CGTTCATGATGAACAATTAC |