Skip to main content

Table 1 PCR primer sets for amplification of SSU rRNA region of Blastocystis from dog faeces

From: Diversity of Blastocystis subtypes in dogs in different geographical settings

Primer Primer name and sequence (5′ to 3′) Product size
Single step PCR conditions as per Scicluna et al. [14] BhRDr -GAGCTTTTTAACTGCAACAACG 600 bp
RD5 –ATCTGGTTGATCCTGCCAGT
Nested PCR–primary set, conditions as per Clark [13] RD3-GGGATCCTGATCCTTCCGCAGGTTCACCTAC 1800 bp
RD5 -GGAAGCTTATCTGGTTGATCCTGCCAGTA
Nested PCR – secondary set, conditions as per Bohm-Gloning [15], using 1 ul of PCR product from primary step. Forward -GGAGGTAGTGACAATAAATC 1100 bp
Reverse - CGTTCATGATGAACAATTAC