Skip to main content

Table 1 Sequences of oligonucleotide primers used for real-time PCR

From: Comparative studies of macrophage-biased responses in mice to infection with Toxoplasma gondii ToxoDB #9 strains of different virulence isolated from China

Target Forward primer (5′-3′) Reverse primer (5′-3′) Length(bp)
TNF-a GAACTTCGGGGTGATCGGTC TGTCTTTGAGATCCATGCCG 221
IL-12p40 TGCCAGGAGGATGTCACCT GGCGGGTCTGGTTTGATGAT 137
iNOS GTTCTCAGCCCAACAATACAAGA GTGGACGGGTCGATGTCAC 127
Arginase-1 CTCCAAGCCAAAGTCCTTAGAG AGGAGCTATCATTAGGGACATC 185
Ym1 AGAAGGGAGTTTCAA ACCTGGT GTCTTGCTCATGTGTGTAAGTGA 109
GAPDH CAACTTTGGCATTGTGGAAGG ACACATTGGGGGTAGGAACAC-3′ 224