Skip to main content

Advertisement

Table 2 Microsatellite markers used to estimate population structure in R. microplus ticks from southern Texas

From: Widespread movement of invasive cattle fever ticks (Rhipicephalus microplus) in southern Texas leads to shared local infestations on cattle and deer

Marker T a Duplex mix Post-PCR dilution Dye A Allele sizes (bp) Citation and/or primer sequence (5’-3’)
PNC75 64 2 1/40 NED 4 139, 143, 145, 147 [28]
PNC98 55 3 1/10 NED 4 135, 139, 141, 143 [28]
PNC153 48 naa 1/15 VIC 16 132, 136, 140, 144, 148, 152, 156, 160, 164, 172, 176, 180, 184, 188, 192, 196 [28] but redesigned R primer (PNC153-R2): TTCAAAGTTCATATGCATGGTC
BmC07 57 1 1/100 NED 8 132, 142, 158, 170, 172, 178, 190, 192 [29] but redesigned R primer (BmC07-R2); GTCAGCCATATGTTCAACCAGA
BmD10 57 1 1/100 6FAM 2 152, 154 [29]
BmB12 67 naa 1/60 6FAM 2 297, 301 [29] but redesigned R primer (BmB12-R2): CGTATGAAGCTATGATGAATAGGAGACGTG
LTF4.3 48 naa 1/15 PET 3 295, 297, 319 [30]
SJB411 55 3 1/10 6FAM 19 159, 187, 191, 195, 215, 219, 223, 227, 231, 239, 243, 251, 259, 263, 267, 271, 275, 279, 283 [30]
KRGinv 55 na na VIC 20 138, 142, 146, 150, 154, 158, 162, 166, 170, 174, 210, 246, 252, 256, 258, 262, 266, 270, 274, 278 [30] Removed from study.
ATC12 64 2 1/40 PET 12 137, 143, 155, 158, 161, 164, 167, 170, 173, 176, 179, 182 [26] F-CAAGCACAGGACCGAGTTGA
[26] R-GTGTGCTTTCGCAATGATCG
ATC15 56 4 1/30 PET 4 187, 205, 208, 211 [26] F-AAAGATTCATGAAGGATGTTGATCG
[26] R-GCCTACAAATTCAACTGAGGGAAAA
ATT20 56 4 1/30 6FAM 25 190, 226, 229, 232, 235, 238, 241, 244, 247, 250, 253, 256, 259, 262, 265, 268, 271, 274, 277, 280, 283, 286, 289, 292, 295 [26] F-CGGTTAATCTACAAACGAAGTCTTG
[26] R-TTTTTATGTAGTGCTTTTTCAACTTTCA
  1. Ta is the annealing temperature in PCR; A is the total number of observed alleles. Loci were amplified in duplexes or as singletons; compatible loci were pooled into a single loading mix before being run on an AB3730. The KRGinv locus was removed from this study due to linkage disequilibrium with PNC153 and amplification of >2 alleles in individuals from some populations.
  2. aLoci listed as “na” in the Duplex Mix column are run singly in separate PCRs, then diluted and pooled together for loading onto an AB3730.