Skip to main content

Advertisement

Table 1 Primers used in present study

From: Cloning and characterization of a mannose binding C-type lectin gene from salivary gland of Aedes albopictus

Gene name Forward primer (5′-3′) Reverse primer (5′-3′) Amplicon size (bp)
Aalb_CTL1 ORF cloning
Aalb_CTL1 ATGGGGCAGCCATCATCATCATCAT ACATTCGTTCGCACACAAAAC 462
Recombinant expression
Aalb_CTL1 GTCCATATG CAACAGGAATGCGACTGTAAAAATAG GTGAAGCTT ACATTCGTTCGCACACAAAAC 405
Quantitative real-time PCR (Q-PCR)
Aalb_CTL1 GCTATCTCTCTCGCAGACCTCAC CCAATCTCCAGCCGTTCCT 130
Rsp 5 ATTACATCGCCGTCAAGGAG TCATCATCAGCGAGTTGGTC 126
  1. The restriction endonuclease sites in italics.