Skip to main content

Table 1 Oligonucleotides used for microsatellite analysis

From: Parental genetic diversity of brown trout (Salmo trutta m. fario) brood stock affects offspring susceptibility to whirling disease

Microsatellite locus Oligonucleotide name Sequence (5′- 3’) Annealing temperature (°C) PCR product size (bp) Reference
Str-15 Str15FAM TGCAGGCAGACGGATCAGGC 60 220-226 [41]
Str-60 Str60FAM CGGTGTGCTTGTCAGGTTTC 60 94-104 [41]
Str-543 Str543NED ATTCTTCGGCTTTCTCTTGC 55 118-152 [42]
Ssa-85 Ssa85NED AGGTGGGTCCTCCAAGCTAC 60 104-116 [44]
Ssa-197 Ssa197HEX GGGTTGAGTAGGGAGGCTTG 60 128-158 [44]
  1. Forward primers were 5’end-labeled with fluorescent dyes FAM, NED and HEX, respectively. R: reverse primer.