Skip to main content

Table 1 Newly developed primers and probe for Rickettsia helvetica targeting a region of the gltA gene

From: Vertical transmission of Bartonella schoenbuchensis in Lipoptena cervi

Primers & probe Oligo name Primer and probe sequences (5′- > 3’) Product length
forward primer Rick_HelvgltA_F2 ATGATCCGTTTAGGTTAATAGGCTTCGGTC 123 bp
reverse primer Rick_HelvgltA_R2 TTGTAAGAGCGGATTGTTTTCTAGCTGTC
Probe (Atto425) Rick_HelvgltA_pr3 ATTO425-CGATC + C + ACG + TG + CCGCAGT-BHQ1 (+ = LNA)
  1. LNA = Locked Nucleic Acid, indicated by symbol ‘+’.