Skip to main content

Table 6 The 23 Aedes albopictus microsatellite loci validated in this study

From: Molecular markers for analyses of intraspecific genetic diversity in the Asian Tiger mosquito, Aedes albopictus

Locus Type 1 Repeat motif Primer sequences (5’ to 3’) 2 T a (°C) 3
Aealbmic1 P (TC)10 F: [6FAM]ACCTTGCGTAGGATGACGAT 60
R: GCCATGATCACGAGCCTATT
Aealbmic2 I (GTT)5TGGAGTGAG(GTT)6 F: [6FAM]ACGATGCGTAACCATTCGAT 58
R: AACACCGCCGAATATGAAAC
Aealbmic3 P (AAC)9 F: [HEX]ACCATACAGCCTGGAGTTCG 58
R: GGGGTTGTGTGAATTGTCGT
Aealbmic4 P (CAA)8 F: [6FAM]ATCGCGGGTTTTCTATTCCT 58
R: ATCAACGAAACCGAAAGCAT
Aealbmic5 P (TGT)13 F: [HEX]AACCCATCGAACACAGAAGG 58
R: GTACGGTTGACTCGCTGTGA
Aealbmic6 I (GTT)3GCT(GTT)3 GGT(GTT)4 F: [HEX]GATGGTCCGTATTTGGGTTG 57
R: ATCTTCACTCATCCGCCATC
Aealbmic7 I (TTG)8ATG(TTG)4 F: [HEX]ATAGACGGGAGTCGGTTCCT 58
R: TCCAACCGCTAGTGTCATCA
Aealbmic8 P (GT)8 F: [HEX]TTGTTGTTCGGTTGTTGTTTG 57
R: CGGGTTCCAACTATGTACGA
Aealbmic9 P (GAT)7 F: [HEX]GCGATGACAGTGGAACAAGA 58
R: GCTTGGCAGGGAACAAATTA
Aealbmic10 P (ATC)9 F: [6FAM]ATCGCCTTCACTCTTCTTCG 60
R: CCAATCCTGAGCCGTACATT
Aealbmic11 P (TGT)5 F: [6FAM]CTCTGCGTTCCGGTTCTATC 58
R: AGGCAACCTCTCGAATGAAA
Aealbmic12 P (GAT)7 F: [6FAM]AGAGCCCTCGAAAAGAGAGC 58
R: AGCACTCATTCTTGGCTTGG
Aealbmic13 I (GAT)GAC(GAT)4 F: [6FAM]TCACACCATGGTCAAAGCAT 58
R: TGCTGAGTTGAATGGAAACG
Aealbmic14 I (CT)11 T(CT)2 F: [6FAM]CAGAAGGTCTTGGATTCACTC 58
R: TTTCCAATTCGTTTCTGGTTC
Aealbmic15 P (GTT)7 F: [6FAM]GGAATGGTTCCCTGGCTAAT 58
R: CCAACTCCGAAGAAGCCATA
Aealbmic16 P (CAT)7 F: [HEX]CACAACAACGAGAGTGTCGAA 60
R: CCGAGGGCAACACGATATAC
Aealbmic17 P (CAA)15 F: TCACCACAACAAACGGAATC 58
R: AGAGTTTTGGGCGCAGTTTA
Aealbmic18 4 I (TG)12TA(TG)7 F: GGGCCGAATCTCATATACCA 59
R: CTCAAATCGGTTGACAGACG
Aealbmic19 P (ATC)9 F: ACATATAGGTAATCCTTGCGCTGAT 59
R: GTTCCCGTATTTGATATTTGCTTT
Aealbmic20 P (CA)44 F: GGAGGCCATCATAATTTCGAC 58
R: AGTGGACCACAGACAGACCATT
Aealbmic21 P (ATG)7 F: CCCTACAGCCCTGATTGAGA 58
R: CGAGTTGGGATGTGTGATTG
Aealbmic22 5 I (AC)45AT(AC)2AT(AC)5 F: AAATCGGTTGAGGTTTACTGC 59
R: ATTCTTAGCCGGCAACTACG
Aealbmic23 P (ACA)8 F: AACGGAGCGGAGTCGATTAT 58
R: CTACTACCCGCTGCCTTCTG
  1. 1Motif type (P: perfect repeats; I: imperfect repeats).
  2. 2The fluorescent label (6FAM or HEX) on the forward primer is indicated for the 16 loci that were subsequently used for the population analysis.
  3. 3Annealing temperature (T a).
  4. 4,5SSR sequences that correspond to previously identified loci: (alb212) [57] and (AealbD2) [58], respectively.