Skip to main content

Table 1 Primers targeting host cytochrome b gene

From: Identification of phlebotomine sand fly blood meals by real-time PCR

Host species Primers CG content Tm (°C) Product size (bp)
Canis lupus familiaris f5′ - AGCGCCGTCTAACATCTCTG - 3′ 55.45 55.90 118
r5′ - TGTGGCTGTGTCCGATGTAT - 3′ 50.89 59.10  
Equus caballus f5′ - CAGCCAGTGGAACACCCATA- 3′ 55.00 59.67 103
r5′ - TGTTTTCGATGGTGCTTGCG - 3′ 50.00 60.04  
Felis catus f5′ - AGAATGGATCTGAGGGGGCT - 3′ 55.00 60.03 108
r5′ - AGGTGTACTGCTGCTAAGGC - 3′ 55.00 59.75  
Gallus gallus f5′ - CAGCAGACACATCCCTAGCC - 3′ 60.00 60.18 104
r5′ - GAAGAATGAGGCGCCGTTTG - 3′ 55.00 60.18  
Homo sapiens f5′ - AGGCGTCCTTGCCCTATTAC- 3′ 55.00 59.53 104
r5′ - GTGATTGGCTTAGTGGGCG - 3′ 55.00 60.39  
Rattus rattus f5′ - GAATTGGGGGCCAACCAGTA - 3′ 55.00 59.00 109
r5′ - TCAATGATTCCGGAGATTGGT - 3′ 42.86 57.00  
  1. CG content: guanine-cytosine content; Tm: melting temperature.