Skip to main content

Table 2 The specific primers used to amplify sodium channel gene mutations detected in Ae. aegypti

From: Relationship between insecticide resistance and kdr mutations in the dengue vector Aedes aegypti in Southern China

Mutation Primers Sequence (5′-3′)
S989P M1-For AATGATATTAACAAAATTGCGC
  M2-Rev GCACGCCTCTAATATTGATGC
  M1-S GCGGCGAGTGGATCGAAT
  M1-P GCGGCGAGTGGATCGAAC
V1016G M2-For GCCACCGTAGTGATAGGAAATC
  M2-Rev CGGGTTAAGTTTCGTTTAGTAGC
  M2-V GTTTCCCACTCGCACAGGT
  M2-G GTTTCCCACTCGCACAGGG
F1534C M3-For GGAGAACTACACGTGGGAGAAC
  M3-Rev CGCCACTGAAATTGAGAATAGC
  M3-F GCGTGAAGAACGACCCGA
  M3-C GCGTGAAGAACGACCCGC