Skip to main content

Table 1 Primer sequences used for RT-PCR and RACE

From: Identification of genes associated with blood feeding in the cat flea, Ctenocephalides felis

Transcript ID
RT-PCR Forward Primer Reverse Primer
B2 tgctctcatcaaagtttctagtgc ccagacgaaagacgtgacaccaac
S5 acccagtggctcgctccgcttatg gctaacataggcagacaagccac
S16 acgacgtcgaacgttttgtgatgc gccttgcaaatttcaccaccct
B43 aacctaaatctgatggcagtgatg cacaattttgtatctgagctttcc
S49 actgttctatccctggtgtcaatg gacaagaaccattcttgaatcctg
B52 catgggtggaatgatattggttac gttgcctaataaatgctgtgtcag
S58 ccatctgtagcctacgactatgtc agcgctcacgtagtcagcaacaa
S61 atgcacatatcccaatatggatac gtttcctaagaacacctttgcaa
B68 agtgaccaccacttcctatgcaac gtaactggagtggaaacaacattg
RACE 5’ RACE Primer 3’ RACE Primer
B2 gcactagaaactttgatgagagca gttggtgtcacgtctttcgtctgg
S5 cataagcggagcgagccactgggt gtggcttgtctgcctatgttagc
S16 gcatcacaaaacgttcgacgtcgt agggtggtgaaatttgcaaggc
B43 catcactgccatcagatttaggtt ggaaagctcagatacaaaattgtg
S49 cattgacaccagggatagaacagt caggattcaagaatggttcttgtc
B52 gtaaccaatatcattccacccatg ctgacacagcatttattaggcaac
S58 gacatagtcgtaggctacagatgg ttgttgctgactacgtgagcgct
S61 gtatccatattgggatatgtgcat ttgcaaaggtgttcttaggaaac
B68 gttgcataggaagtggtggtcact caatgttgtttccactccagttac