Skip to main content

Table 1 Primer sequences used for the qPCR assay and probes and PNA sequences used for the Reverse line blotting method in this study

From: Reliability of molecular host-identification methods for ticks: an experimental in vitro study with Ixodes ricinus

Name Target organism Position Sequence
12Sgg Chicken (Gallus gallus) Forward CTCGCTAATAAGACAGGTCAAGGTA
Chicken probe Chicken (Gallus gallus) - Amino-ACCTCCCATCACACATGT
Sheep probe Sheep (Ovis aries) - Amino-AAATAATTATAAAAACAAAATTATTC
PNA clamp Human (Homo sapiens) Reverse H-GTGTTCTGGCGAGCAGTT-NH2