Skip to main content

Advertisement

Table 1 Primer sequences and locus characteristics.

From: Genome-wide discovery and development of polymorphic microsatellites from Leishmania panamensis parasites circulating in central Panama

Locus Primers (5´ → 3´)a Chrb Locc Repeat motif Regiond Tae (°C) Fragment sizes (bp)f
M75 TCCCTAATCGTCCGTGTCAC 35 2041025 AGG NC 56 258-270
CAGTGACGAGCTGGAAATGC
M78 AACAAGGCACGGGAAATTGG 35 2220491 AAC NC 56 333-339
CGTCTGTTGCTCCGTCTTTG
M80 CCGCCGAGAAGCCTGAAG 29 193463 AGC C 56 237-255
GCAACAGTACGAGAAGTGGC
M81 CATCATTCAGCAGTGCGGG 29 246586 AGG NC 56 329-347
AAAGGAAGTGATGCGTGCAC
M140 GATTGTCGCCCTCATCAACG 17 494896 AGG NC 64 236-263
GAGAAGAGAGGGTCGAGCTC
M147 TCTCCTTGGCTTTCCTCTCC 26 483774 AGG NC 66 192-210
ACATATTCGCGCGCCTAATG
M149 TTCTGCCTTGTTGTTGCTCC 13 534713 AGG NC 56 288-312
CACATCGGCCTCCATAACAC
M155 ACAAGAATGCCAAGCTGTCG 13 329823 AGC C 62 314-323
CCTCTGCTGCTTCCTGTTTC
M166 ACTCCCTGGATAGTGGCAAC 7 107131 AGC C 62 194-206
ATGCGGTGCGTGATGTTATG
M196 ATCAGCAGCAACTCTCCCAG 12 147953 AGC C 62 288-300
GAGATACCGGAGACAGCGG
M202 CAGGGAGAAGAAGGGATGGC 5 267314 AGG C 56 285-318
TCCTTTGCCTCAGTCCGTAC
M207 CTTTGACGGGCTCATCAGTG 5 251336 AGC C 56 321-333
AAGGAGCGAGAAGTAGAGGC
M233 TCTGCGGTGAGGATGCTAC 3 102343 ACC C 56 195-300
GCTACTACCTCTGCTCACCC
M269 TGCTGTTGACTGAATGCACTG 33 279723 AGG NC 62 327-366
TTTCCTCCACTCCCGTCTTC
M292 GACTTAACGGATGCGCTGAC 20 158471 ACC NC 62 240-252
GGAGCACTGAAGTAAAGCGG
M329 CCAGTCTCTTCCACCTACCC 27 715534 AGGG NC 56 228-232
GATGGAAGGGTGCACACATC
M402 GCAGCAGTCGATTGTGAAGG 5 228009 AGAGG NC 64 130-140
CCCTTTACATGCTGCTTGGG
  1. aUpper line, forward primer; lower line, reverse primer. Forward primer had tail attached at 5´ (GCCTCCCTCGCGCC)
  2. bChromosomal position based on L. panamensis full genome assembly
  3. cChromosomal location, considering numbering of the first nucleotide of repeat 1
  4. dLocation of microsatellite in coding (C) or non-coding (NC) regions
  5. eAnnealing temperature
  6. fRange of fragment sizes found in L. panamensis strains tested so far