Skip to main content

Advertisement

Table 1 Primers of the candidate reference genes for qPCR

From: Reference gene stability of a synanthropic fly, Chrysomya megacephala

Gene Accession number Primer sequences (5' → 3') PCR products (bp)a Ea (%) R2 b
Actin KC207081 F: ACACCATCACCAGAATCCAAG 149 97.6 0.994
   R: TTAAACCCCAAGGCTAACCG    
Rpl8 KM289151 F: CTCCAAATCGGCAATGTGATG 148 93.9 0.992
   R: TCTTGGTGTCAGGGTTGTG    
GAPDH KM289150 F: AGTTATCCCTGCCTTGAACG 132 97.1 0.998
   R: AAGACCTTAGCCTTGATGTCG    
EF1 FR719225 F: TTCACCGCTCAAGTCATCG 122 95.0 0.998
   R: TCGACCTTCTCCTTGATTTCAG    
α-TUB KM289152 F: GAAGGTGAATTCTCTGAGGCC 144 98.0 0.974
   R: GTCTTTTGGTTTGTGGAACGAG    
β-TUB KM289153 F: CCATTTCATCCATACCCTCACC 141 92.5 0.994
   R: GCTTGAAAATGTCTGCCACC    
TBP KM387673 F: TCATCCGCAACTCCATCTTC 127 98.7 0.991
   R: TGGGCGACATAAGACTTTGTG    
18S FJ025483 F: AGCGTATTACCGGTGGAGTTCT 78 92.5 0.994
   R:CTGAAGCAGGTTTAAATAGGAGGA    
Rps7 KM289154 F: CCTTTTCACGAGCCGCTTCC 76 90.4 0.999
   R: GTGCCGGTACCCGTTACTGA    
  1. aqPCR efficiency (calculated by the standard curve method)
  2. bRegression coefficient of theqPCR reaction