Skip to main content

Advertisement

Table 1 Primers used in this study

From: Identification and characterization of Clonorchis sinensis cathepsin B proteases in the pathogenesis of clonorchiasis

Gene Primers Gene length
CsCB1 F: 5′GCCGAATTCACGAGTATATTCCATCTTTC3′ 960 bp
R: 5′CGCTCTAGAAGCAGTTTTGGATGACCAG3′
CsCB2 F: 5′GTCGAATTCACGAAAATCTGGGGAGCGT3′ 966 bp
R: 5′GCCTCTAGAACAAAATGCGGAATGGTGG3′
CsCB3 F: 5′CGACTGCAGGAACAGAATCGATTGGACT3′ 960 bp
R: 5′GGCTCTAGAATCTTAAGTGGGATGCTGG3′
CsCB4 F: 5′GTACTGCAGGAAAACCAAAGCACGAAGC3′ 987 bp
R: 5′GCGGTCTAGAGGCGAAAAGGATTCATGATT3′