Skip to main content

Table 2 Primers of the 8 microsatellite loci in O. hupensis

From: The genetic diversity and geographical separation study of Oncomelania hupensis populations in mainland China using microsatellite loci

Locus Primer sequence (5′ → 3′) Repeat motif Annealing tempreture/(°C) Allele size from field snails (bp) NO. of mutilplex PCR GenBank accession No.
T1-10 Pf: TCACTCGGGTGTAATGCT (GA)38 55 173–259 1 GU204080
Pr: TTTGTTACTGATGGTGGC
T4-25 Pf: CAATAGTTCGACTCGGAAGA (CT)35 52 142–228 1 GU204084
Pr: CGAGGTATGGCGTTGCTT
T4-22 Pf: TATCCAAGAAGCCGAAAC (CA)10 50 224–256 1 GU204083
Pr: GAGGAAAGCGAGGTAAGA
D11 Pf: TTCAGTTGTCTTATTTCGTG (TG)17 55 141–192 1 GU204223
Pr: TAGATGTTCACTGGTTTGTC
T5-11 Pf: ACGCCAGTCTTGGTGTCA (GT)14 55 153–210 2 GU204092
Pr: TACTTGGGCAGAAGGGTT
T6-17 Pf: GCTGTCCTTTTACCAACTGC (AC)8 55 192–248 2 GU204108
Pr: TATCAAAGGATTATGCCGAG
A18 Pf: GCCGATGATACAAGACCC (CT)18 60 131–256 2 GU204047
Pr: GAGAATCTCCAGGCACGC
C22 Pf: CGGTACATCTGGATAGTGG (CA)21 62 185–239 2 GU204145
Pr: TGCGAAACAGTTGCAGACAC