Skip to main content

Advertisement

Table 1 Primers and probes used in tick species determination and pathogen screening

From: Tick-borne bacterial pathogens in southwestern Finland

Primer/probe name Primer/probe target 5’ → 3’ Reference
qPCR:    
 IXO-I2-F4 Ixodes spp. ITS2 TCTCGTGGCGTTGATTTGC This paper
 IXO-I2-R4 Ixodes spp. ITS2 CTGACGGAAGGCTACGACG  
 Ipe-I2-P4 I. persulcatus ITS2 [FAM]-TGCGTGGAAAGAAAACGAG-[BHQ1]  
 Iri-I2-P4 I. ricinus ITS2 [VIC]-TGCTCGAAGGAGAGAACGA-[BHQ1]  
 Bb23Sf B. burgdorferi 23S RNA CGAGTCTTAAAAGGGCGATTTAGT Courtney et al. [83]
 Bb23Sr B. burgdorferi 23S RNA GCTTCAGCCTGGCCATAAATAG  
 Bb23Sp B. burgdorferi 23S RNA [FAM]-AGATGTGGTAGACCCGAAGCCGAGTG-[BHQ1]  
 Bmi-F B. miyamotoi glpQ CACGACCCAGAAATTGACACA Vayssier-Taussat et al. [84]
 Bmi-R B. miyamotoi glpQ GTGTGAAGTCAGTGGCGTAAT
 Bmi-P B. miyamotoi glpQ [FAM]-TCGTCCGTTTTCTCTAGCTCGATTGGG-[BHQ1]  
 Bart-ssRA-F Bartonella ssRa GCTATGGTAATAAATGGACAATGAAATAA Diaz et al. [85]
 Bart-ssRA-R Bartonella ssRa GCTTCTGTTGCCAGGTG  
 Bart-ssRA-P Bartonella ssRa [FAM]-ACCCCGCTTAAACCTGCGACG-[BHQ1]  
 Rspp-F Rickettsia gltA GAGAGAAAATTATATCCAAATGTTGAT Labruna et al. [86]
 Rspp-R Rickettsia gltA AGGGTCTTCGTGCATTTCTT  
 Rspp-P Rickettsia gltA [CY5]-CATTGTGCCATCCAGCCTACGGT-[BHQ3]  
 CNe-F Ca. N. mikurensis groEL AGAGACATCATTCGCATTTTGGA Vayssier-Taussat et al. [84]
 CNe-R Ca. N. mikurensis groEL TTCCGGTGTACCATAAGGCTT  
 CNe-P Ca. N. mikurensis groEL [TAMRA]-AGATGCTGTTGGATGTACTGCTGGACC-[BHQ2]  
PCR:    
 CS877f Rickettsia gltA TAATACGACTCACTATAGGGGGGGACCTGCTCACGGCGG Mediannikov et al. [87]
 CS1258r Rickettsia gltA ATTAACCCTCACTAAAGATTGCAAAAAGTACAGTGAACA