Skip to main content

Table 1 Primers used in the present study for evaluation of expression of the ABC subfamily B genes (ABCB1, ABCB6, ABCB8 and ABCB10) in the Ixodes ricinus cell line IRE/CTVM19

From: Evaluation of the in vitro expression of ATP binding-cassette (ABC) proteins in an Ixodes ricinus cell line exposed to ivermectin

  Primer sequences
ABCB1 F: 5′ – TCTTTGCCGTCTTCTACAG – 3′
R: 5′ – CAGGTTCTCTCCAGCGAT – 3′
ABCB6 F: 5′ – AGACTATGTCCTCTTCCTCA – 3′
R: 5′ – CATCTATCACCTCTGCCTT – 3′
ABCB8 F: 5′ – ATCAGGAACGCCGACATC – 3′
R: 5′ – AGTTTCCAGTAGACACCCTT – 3′
ABCB10 F: 5′ – TGTCCTAACCATTGCTCACA – 3′
R: 5′ – TGATGTTCCACTAATGTCCG – 3′
β-Actin F: 5′ – CACGGCATCGTGACCAACTG – 3′
R: 5′ – CGAACATGATCTGAGTCATCTTCTC – 3′