Skip to main content

Table 1 Primers used for PCR amplification or sequencing of SSU rDNA, ITS and LSU rDNA of Myxobolus pronini n. sp

From: Morphological and molecular characterisation of Myxobolus pronini n. sp. (Myxozoa: Myxobolidae) from the abdominal cavity and visceral serous membranes of the gibel carp Carassius auratus gibelio (Bloch) in Russia and China

Primer Sequence Reference
MyxospecF TTCTGCCCTATCAACTTGTTG [15]
18R CTACGGAAACCTTGTTACG [13]
18R-V CGTAACAAGGTTTCCGTAG [13]
Myxo28S1F-V CACTTCACTCGCAGTTACT [14]
NLF160 ACCTCCACTCAGGCAAGATTA [16]
NLR1694 TCTYAGGAYCGACTNAC [16]
NLF1050 AATCGAACCATCTAGTAGCTGG [17]
NLR3284 TTCTGACTTAGAGGCGTTCAG [17]